91
|
Sino Biological
n dykddddk flag tag N Dykddddk Flag Tag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n dykddddk flag tag/product/Sino Biological Average 91 stars, based on 1 article reviews
n dykddddk flag tag - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
91
|
Sino Biological
his park2 His Park2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/his park2/product/Sino Biological Average 91 stars, based on 1 article reviews
his park2 - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
91
|
Sino Biological
hg12092 ut  Hg12092 Ut, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hg12092 ut/product/Sino Biological Average 91 stars, based on 1 article reviews
hg12092 ut - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
90
|
Qiagen
sirna murine park2 target sequence: accattgggcctgctggtcta Sirna Murine Park2 Target Sequence: Accattgggcctgctggtcta, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna murine park2 target sequence: accattgggcctgctggtcta/product/Qiagen Average 90 stars, based on 1 article reviews
sirna murine park2 target sequence: accattgggcctgctggtcta - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Genechem
park2 overexpression plasmid Park2 Overexpression Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/park2 overexpression plasmid/product/Genechem Average 90 stars, based on 1 article reviews
park2 overexpression plasmid - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
91
|
Sino Biological
human park2 gene orf cdna clone expression plasmid, n-his tag Human Park2 Gene Orf Cdna Clone Expression Plasmid, N His Tag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human park2 gene orf cdna clone expression plasmid, n-his tag/product/Sino Biological Average 91 stars, based on 1 article reviews
human park2 gene orf cdna clone expression plasmid, n-his tag - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
90
|
Beijing Genomics Institute Shenzhen
plasmid pmscv-gfp-park2 Plasmid Pmscv Gfp Park2, supplied by Beijing Genomics Institute Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid pmscv-gfp-park2/product/Beijing Genomics Institute Shenzhen Average 90 stars, based on 1 article reviews
plasmid pmscv-gfp-park2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
OriGene
parkin (park2) human shrna plasmid kit Parkin (Park2) Human Shrna Plasmid Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/parkin (park2) human shrna plasmid kit/product/OriGene Average 90 stars, based on 1 article reviews
parkin (park2) human shrna plasmid kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
N/A
|
PARK2 Human 4 unique 29mer shRNA constructs in retroviral untagged vector
|
Buy from Supplier |
N/A
|
Full length Clone DNA of Human Parkinson disease autosomal recessive juvenile 2 parkin with N terminal GFPSpark tag
|
Buy from Supplier |
N/A
|
Park2 Mouse 4 unique 29mer shRNA constructs in lentiviral GFP vector
|
Buy from Supplier |
Image Search Results
Journal: International Journal of Molecular Sciences
Article Title: Parkin Precipitates on Mitochondria via Aggregation and Autoubiquitination
doi: 10.3390/ijms24109027
Figure Lengend Snippet: List of plasmids.
Article Snippet: pCMV3-non-tagged Parkin ,
Techniques: